Acta Metallurgica Sinica (English Letters) ›› 2024, Vol. 37 ›› Issue (1): 54-66.DOI: 10.1007/s40195-023-01573-0
Special Issue: 2024年增材制造专辑
Previous Articles Next Articles
Jiaxin Li1,2, Haozhang Zhong3, Bojun Cao2, Zhaoyang Ran2, Jia Tan2, Liang Deng2, Yongqiang Hao2(
), Jinglong Yan1(
)
Received:2023-04-07
Revised:2023-04-18
Accepted:2023-04-28
Online:2024-01-10
Published:2023-07-08
Contact:
Yongqiang Hao, Jiaxin Li, Haozhang Zhong, Bojun Cao, Zhaoyang Ran, Jia Tan, Liang Deng, Yongqiang Hao, Jinglong Yan. Comparative Study of 3D-Printed Porous Titanium Alloy with Rod Designs of Three Different Geometric Structures for Orthopaedic Implantation[J]. Acta Metallurgica Sinica (English Letters), 2024, 37(1): 54-66.
Add to citation manager EndNote|Ris|BibTeX
Fig. 2 Preparation and characterization of porous scaffolds with different rod geometric designs: a-c design drawing display, d general picture of porous scaffold, e stress-strain curves of 3 kinds of scaffolds
| Gene | Forward primer sequence (5′-3′) | Reverse primer sequence (3′-5′) |
|---|---|---|
| GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
| Notch1 | GATGGCCTCAATGGGTACAAG | TCGTTGTTGTTGATGTCACAGT |
| YAP | GGCTCTAAAGAACCCGAACC | GCAGCTGAAGAAACCACCTC |
| Piezo 1 | CACTGGCCCAGAGCTTCTAC | ATGTCTGTGGCTGCAGAGTG |
| Jag 1 | TGCCTCTGTGAGACCAACTG | AGGGGTCAGAGAGACAAGCA |
| NF-KB | CTGACCTGAGCCTTCTGGAC | GCAGGCTATTGCTCATCACA |
Table 1 Primers used for quantitative RT-PCR analysis
| Gene | Forward primer sequence (5′-3′) | Reverse primer sequence (3′-5′) |
|---|---|---|
| GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
| Notch1 | GATGGCCTCAATGGGTACAAG | TCGTTGTTGTTGATGTCACAGT |
| YAP | GGCTCTAAAGAACCCGAACC | GCAGCTGAAGAAACCACCTC |
| Piezo 1 | CACTGGCCCAGAGCTTCTAC | ATGTCTGTGGCTGCAGAGTG |
| Jag 1 | TGCCTCTGTGAGACCAACTG | AGGGGTCAGAGAGACAAGCA |
| NF-KB | CTGACCTGAGCCTTCTGGAC | GCAGGCTATTGCTCATCACA |
Fig. 4 Cell proliferation and adhesion on the surface of scaffolds designed with three different rod geometric structures: a cell proliferation of scaffolds designed with three different rod geometric structures, b-d confocal laser scanning images of MC3T3-E1 cells on the scaffold surface with three different geometric rod designs
Fig. 5 Cell proliferation of scaffolds designed with the pore size control and surface area control of three different rod geometric structures: a cell proliferation of pore size control scaffolds designed with three different rod geometric design, b cell proliferation of surface area control scaffolds designed with three different rod geometric design
Fig. 6 Osteogenic activity of MC3T3-E1 cells on three scaffolds with different rod geometric structures: a alkaline phosphatase activity was different among different groups after 7 days of culture, b alkaline phosphatase activity was different among different groups after 14 days of culture, c alizarin red staining of MC3T3-E1 cells cultured on scaffolds with three different rod geometric designs, d semiquantitative detection of alizarin red
Fig. 7 Relative gene expression levels of MC3T3-E1 cells cultured on scaffolds designed with rods of three different geometric designs: relative gene expression levels of Piezo1, YAP, Notch1, Jag1 and NF-KB between three different scaffolds
Fig. 8 Cell proliferation of scaffolds designed with the pore size control and surface area control of three different rod geometric structures after inhibitor: a cell proliferation of pore size control scaffolds designed with three different rod geometric designs after GsMTx4 treated, b cell proliferation of surface area control scaffolds designed with three different rod geometric designs after GsMTx4 treated, c cell proliferation of pore size control scaffolds designed with three different rod geometric designs after verteporfin treated, d cell proliferation of surface area control scaffolds designed with three different rod geometric designs after verteporfin treated
Fig. 9 Relative gene expression levels of MC3T3-E1 cells cultured on scaffolds designed with rods of three different geometric designs after GsMTx4 treated: Relative gene expression levels of Piezo1, YAP, Notch1, Jag1 and NF-KB between three different scaffolds after GsMTx4 treated
Fig. 10 Relative gene expression levels of MC3T3-E1 cells cultured on scaffolds designed with rods of three different geometric designs after verteporfin treated: Relative gene expression levels of Piezo1, YAP, Notch1, Jag1 and NF-KB between three different scaffolds after verteporfin treated
| [1] | C. Ma, T. Du, X. Niu, Y. Fan, Bone Res. 10, 59 (2022) |
| [2] | K. Choi, J.L. Kuhn, M.J. Ciarelli, S.A. Goldstein, J. Biomech. 23, 1103 (1990) |
| [3] | Y. Heriveaux, S. Le Cann, M. Fraulob, E. Vennat, V.H. Nguyen, G. Haiat, Med. Biol. Eng. Comput. 60, 3281 (2022) |
| [4] | P. Wang, F.H. Chen, J. Eckert, S. Pilz, K.G. Prashanth, J. Cent, South Univ. 28, 1068 (2021) |
| [5] | S.J. Yu, P. Wang, H.C. Li, R. Setchi, M.W. Wu, Z.Y. Liu, Z.W. Chen, S. Waqar, L.C. Zhang, Virtual Phys. Prototyp. 18, e2155197(2023) |
| [6] | R. Baptista, M. Guedes, J. Mech. Behav. Biomed. Mater. 117, 104378 (2021) |
| [7] | S. Arabnejad, R. Burnett Johnston, J.A. Pura, B. Singh, M. Tanzer, D. Pasini, Acta Biomater. 30, 345 (2016) |
| [8] | G. Li, L. Wang, W. Pan, F. Yang, W. Jiang, X. Wu, X. Kong, K. Dai, Y. Hao, Sci. Rep. 6, 34072 (2016) |
| [9] | C.M. Bidan, K.P. Kommareddy, M. Rumpler, P. Kollmannsberger, P. Fratzl, J.W. Dunlop, Adv. Healthc. Mater. 2, 186 (2013) |
| [10] | S.J.P. Callens, R.J.C. Uyttendaele, L.E. Fratila-Apachitei, A.A. Zadpoor, Biomaterials 232, 119739 (2020) |
| [11] | Q. Wang, Y. Huang, Z. Qian, J. Biomed. Nanotechnol. 14, 628(2018) |
| [12] | C. Hou, J. An, D. Zhao, X. Ma, W. Zhang, W. Zhao, M. Wu, Z.Zhang, F. Yuan, Front. Bioeng. Biotechnol. 10, 835008 (2022) |
| [13] | J.O. Abaricia, A.H. Shah, M. Chaubal, K.M. Hotchkiss, R. Olivares-Navarrete, Biomaterials 243, 119920 (2020) |
| [14] | S. Zhang, Y. Wang, B. Zhou, F. Meng, H. Zhang, S.J. Li, Q.M. Hu, L. Zhou, Acta Metall. Sin. -Engl. Lett. 36, 35 (2023) |
| [15] | D. Martinez-Marquez, Y. Delmar, S. Sun, R.A. Stewart, Materials (Basel) 13, 4794 (2020) |
| [16] | M. Alana, A. Lopez-Arancibia, S. Ghouse, N. Rodriguez-Florez, S. Ruiz de Galarreta, Comput. Biol. Med. 150, 105761 (2022) |
| [17] | J. Parthasarathy, B. Starly, S. Raman, A. Christensen, J. Mech. Behav. Biomed. Mater. 3, 249 (2010) |
| [18] | W.M. Peng, Y.F. Liu, X.F. Jiang, X.T. Dong, J. Jun, D.A. Baur, J.J. Xu, H. Pan, X. Xu, J. Zhejiang Univ. Sci. B 20, 647 (2019) |
| [19] | R. Thibeaux, H. Duval, B. Smaniotto, E. Vennat, D. Neron, B. David, Biotechnol. Prog. 35, 2880 (2019) |
| [20] | C.H. Seo, K. Furukawa, Y. Suzuki, N. Kasagi, T. Ichiki, T. Ushida, Macromol. Biosci. 11, 938 (2011) |
| [21] | Y. Sun, B. Wan, R. Wang, B. Zhang, P. Luo, D. Wang, J.J. Nie, D. Chen, X. Wu, Front. Cell Dev. Biol. 10, 808303 (2022) |
| [22] | W. Li, F. Dai, S. Zhang, F. Xu, Z. Xu, S. Liao, L. Zeng, L. Song, F. Ai, ACS Appl. Mater. Interfaces 14, 20693 (2022) |
| [23] | V. Karageorgiou, D. Kaplan, Biomaterials 26, 5474 (2005) |
| [24] | D.J. Lee, J. Kwon, Y.I. Kim, X. Wang, T.J. Wu, Y.T. Lee, S. Kim, P. Miguez, C.C. Ko, Orthod. Craniofac. Res. 22(Suppl 1), 127(2019) |
| [25] | S. Ehrig, B. Schamberger, C.M. Bidan, A. West, C. Jacobi, K. Lam, P. Kollmannsberger, A. Petersen, P. Tomancak, K. Kommareddy, F.D. Fischer, P. Fratzl, J.W.C. Dunlop, Sci. Adv. 5, 1(2019). https://doi.org/10.1126/sciadv.aav9394 |
| [26] | M. Werner, N.A. Kurniawan, C.V.C. Bouten, Materials (Basel) 13, 963 (2020) |
| [27] | D. Martinez-Moreno, G. Jimenez, C. Chocarro-Wrona, E. Carrillo, E. Montanez, C. Galocha-Leon, B. Clares-Naveros, P. Galvez-Martin, G. Rus, J. de Vicente, J.A. Marchal, Mater. Sci. Eng. C Mater. Biol. Appl. 122, 111933 (2021) |
| [28] | J. Hu, S. Wang, B. Li, F. Li, Z. Luo, L. Liu, IEEE. Trans. Vis Comput. Graph. 28, 2615 (2022) |
| [29] | D.A. Muller, U. Silvan, Int. J. Dev. Biol. 63, 1 (2019) |
| [30] | K. Xie, Y. Guo, S. Zhao, L. Wang, J. Wu, J. Tan, Y. Yang, W. Wu, W. Jiang, Y. Hao, Clin. Orthop. Relat. Res. 477, 2772 (2019) |
| [31] | K.A. DeMali, X. Sun, G.A. Bui, Biochemistry 53, 7706 (2014) |
| [32] | M. Paris, A. Gotz, I. Hettrich, C.M. Bidan, J.W.C. Dunlop, H. Razi, I. Zizak, D.W. Hutmacher, P. Fratzl, G.N. Duda, W. Wagermaier, A. Cipitria, Acta Biomater. 60, 64 (2017) |
| [33] | S.M. Yu, J.M. Oh, J. Lee, W. Lee-Kwon, W. Jung, F. Amblard, S. Granick, Y.K. Cho, Acta Biomater. 77, 311 (2018) |
| [34] | X.Z. Fang, T. Zhou, J.Q. Xu, Y.X. Wang, M.M. Sun, Y.J. He, S.W. Pan, W. Xiong, Z.K. Peng, X.H. Gao, Y. Shang, Cell Biosci. 11, 13 (2021) |
| [35] | J.L. Yu, H.Y. Liao, Biomed. Pharmacother. 140, 111692 (2021) |
| [36] | Y. Jiang, X. Yang, J. Jiang, B. Xiao, Trends Biochem. Sci. 46, 472(2021) |
| [37] | A.H. Lewis, J. Grandl, Elife 4, 12088 (2015) |
| [38] | M. Fu, Y. Hu, T. Lan, K.L. Guan, T. Luo, M. Luo, Signal Transduct. Target. Ther. 7, 376 (2022) |
| [39] | M. Aragona, T. Panciera, A. Manfrin, S. Giulitti, F. Michielin, N. Elvassore, S. Dupont, S. Piccolo, Cell 154, 1047 (2013) |
| [40] | W.B. Swanson, M. Omi, S.M. Woodbury, L.M. Douglas, M. Eberle, P.X. Ma, N.E. Hatch, Y. Mishina, Int. J. Mol. Sci. 23, 4499 (2022) |
| [41] | M. Yoneda, H. Suzuki, N. Hatano, S. Nakano, Y. Muraki, K. Miyazawa, S. Goto, K. Muraki, Int. J. Mol. Sci. 20, 4960 (2019) |
| [42] | K. Hasegawa, S. Fujii, S. Matsumoto, Y. Tajiri, A. Kikuchi, T. Kiyoshima, J. Pathol. 253, 80 (2021) |
| [43] | Y. Liu, Q. Yang, Y. Wang, M. Lin, Y. Tong, H. Huang, C. Yang, J. Wu, B. Tang, J. Bai, C. Liu, A.C.S. Biomater, Sci. Eng. 8, 3498(2022) |
| [44] | L. Li, S. Yang, L. Xu, Y. Li, Y. Fu, H. Zhang, J. Song, Acta Biomater. 96, 674 (2019) |
| [45] | C. Bae, F. Sachs, P.A. Gottlieb, Biochemistry 50, 6295 (2011) |
| [46] | K. Vigneswaran, N.H. Boyd, S.Y. Oh, S. Lallani, A. Boucher, S.G. Neill, J.J. Olson, R.D. Read, Clin. Cancer Res. 27, 1553 (2021) |
| [47] | H. Wei, F. Wang, Y. Wang, T. Li, P. Xiu, J. Zhong, X. Sun, J. Li, Cancer Sci. 108, 478 (2017) |
| [48] | Y. Xu, L. Li, Y. Tang, J. Yang, Y. Jin, C. Ma, Eur. J. Pharmacol. 865, 172794 (2019) |
| No related articles found! |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
WeChat
